Cat.No.：D30011A
Price: ￥
Specifications：
pPIC9K is a Pichia pastoris protein expression vector for protein production with high-copy expression level. It carries ampicillin (Amp) and kanamycin (Kan) resistance genes. Pichia pastoris transformants can be screened on histidine-deficient medium, followed by geneticin (G-418) resistance screening. Secretory expression is available owing to the α-Factor signal peptide.
| Vector Type | Pichia pastoris Expression Vector |
| Cloning Method | Multiple Cloning Sites, Restriction Endonucleases |
| Vector Size | 9276 bp |
| Vector Tag | α-Factor |
| Vector Resistance | Prokaryote: Ampicillin (Amp), Kanamycin (Kan) Eukaryote: Geneticin (G-418) |
| 3' Sequencing Primer Sequence | 3'AOX: GGCAAATGGCATTCTGACAT |
| 5' Sequencing Primer Sequence | 5'AOX: GACTGGTTCCAATTGACAAGC |
Efficient Expression: The methanol-induced AOX1 promoter enables high-level expression of exogenous genes;
Efficient Expression: The methanol-induced AOX1 promoter enables high-level expression of exogenous genes;
Easy Purification: The secretory expression strategy allows the target protein to be directly secreted into the culture medium, simplifying the purification process and reducing production costs;
Sulfation Modification: As a eukaryotic organism, Pichia pastoris can perform sulfation modification on the expressed protein, which enhances the stability and biological activity of the protein;
Genetic Stability: It has good genetic stability in Pichia pastoris;
Multiple Plasmid Sites: Provides multiple restriction enzyme cutting sites, facilitating the insertion and modification of exogenous genes.
| Cat. No. | Component | Specification | Quantity |
| B61011A | pPIC9k | 20 μg | 1 |
Store at -20℃ and transport at ≤0℃.
This product is commonly used in the construction of the Pichia pastoris expression system and can guide the secretion of the expressed protein.
What are the differences between pPIC9K and pPIC9?
In pPIC9K, the "K" indicates kanamycin resistance, which is represented as G418 in yeast. It can be used as a kanamycin selection marker in Escherichia coli and is employed in yeast for screening high-copy-number transformants through a G418 concentration gradient.
Which site in Pichia pastoris is pPIC9K integrated into?
pPIC9K is an integrated vector that needs to be integrated into the genome of Pichia pastoris through homologous recombination to be stably present and expressed. Depending on the restriction endonuclease used for linearizing the vector, it can be integrated at different sites: Using SacI for linearization: Integrate the expression cassette into the AOX1 locus. Obtain the Mut⁺ (normal methanol utilization) phenotype in the GS115 strain; obtain the Mutˢ (slow methanol utilization) phenotype in the KM71 strain. Using SalI or StuI for linearization: Integrate the expression cassette into the his4 locus. Obtain the His⁺ Mut⁺ phenotype in the GS115 strain; obtain the His⁺ Mutˢ phenotype in the KM71 strain. Using BglII for linearization: Integrate the expression cassette into the AOX1 region of GS115, obtaining the Mutˢ phenotype.
